Review



pet21 sae k121r k80r k132r k134r  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Addgene inc pet21 sae k121r k80r k132r k134r

    Pet21 Sae K121r K80r K132r K134r, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pet21 sae k121r k80r k132r k134r/product/Addgene inc
    Average 86 stars, based on 1 article reviews
    pet21 sae k121r k80r k132r k134r - by Bioz Stars, 2026-05
    86/100 stars

    Images

    1) Product Images from "Amine Landscaping to Maximize Protein-Dye Fluorescence and Ultrastable Protein-Ligand Interaction"

    Article Title: Amine Landscaping to Maximize Protein-Dye Fluorescence and Ultrastable Protein-Ligand Interaction

    Journal: Cell Chemical Biology

    doi: 10.1016/j.chembiol.2017.06.015


    Figure Legend Snippet:

    Techniques Used: Virus, Recombinant, Avidin-Biotin Assay, Blocking Assay, Plasmid Preparation, Bicinchoninic Acid Protein Assay, Sequencing, Software



    Similar Products

    pet21 sae k121r k80r k132r k134r  (Addgene inc)
    86
    Addgene inc pet21 sae k121r k80r k132r k134r

    Pet21 Sae K121r K80r K132r K134r, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pet21 sae k121r k80r k132r k134r/product/Addgene inc
    Average 86 stars, based on 1 article reviews
    pet21 sae k121r k80r k132r k134r - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    plasmids for flavidin  (Addgene inc)
    86
    Addgene inc plasmids for flavidin
    Validation of <t>Flavidin</t> Thermostability and Ligand Binding (A) Flavidin thermostability after heating for 3 min in PBS at the indicated temperature and then analysis of tetramer integrity by SDS-PAGE with Coomassie blue staining. C is a control boiled in SDS before loading. (B) Biotin-4-fluorescein association rates <t>for</t> <t>Flavidin</t> with or without 635P-NHS labeling (mean ± 1 SD, n = 9). (C) Biotin-4-fluorescein dissociation rates for Flavidin with or without 635P-NHS labeling (mean of triplicate ± 1 SD). See also <xref ref-type=Figure S4 . " width="250" height="auto" />
    Plasmids For Flavidin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmids for flavidin/product/Addgene inc
    Average 86 stars, based on 1 article reviews
    plasmids for flavidin - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    plasmid 89881  (Addgene inc)
    86
    Addgene inc plasmid 89881

    Plasmid 89881, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid 89881/product/Addgene inc
    Average 86 stars, based on 1 article reviews
    plasmid 89881 - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    genbank accession number mf150043  (Addgene inc)
    86
    Addgene inc genbank accession number mf150043

    Genbank Accession Number Mf150043, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genbank accession number mf150043/product/Addgene inc
    Average 86 stars, based on 1 article reviews
    genbank accession number mf150043 - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    plasmid 46367 pet21 streptavidin k121r this paper addgene plasmid 89880 pet21 flavidin this paper addgene plasmid 89881 software  (Addgene inc)
    93
    Addgene inc plasmid 46367 pet21 streptavidin k121r this paper addgene plasmid 89880 pet21 flavidin this paper addgene plasmid 89881 software

    Plasmid 46367 Pet21 Streptavidin K121r This Paper Addgene Plasmid 89880 Pet21 Flavidin This Paper Addgene Plasmid 89881 Software, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid 46367 pet21 streptavidin k121r this paper addgene plasmid 89880 pet21 flavidin this paper addgene plasmid 89881 software/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    plasmid 46367 pet21 streptavidin k121r this paper addgene plasmid 89880 pet21 flavidin this paper addgene plasmid 89881 software - by Bioz Stars, 2026-05
    93/100 stars
    		  Buy from Supplier
    pet21 flavidin  (Addgene inc)
    86
    Addgene inc pet21 flavidin

    Pet21 Flavidin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pet21 flavidin/product/Addgene inc
    Average 86 stars, based on 1 article reviews
    pet21 flavidin - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: Cell Chemical Biology

    Article Title: Amine Landscaping to Maximize Protein-Dye Fluorescence and Ultrastable Protein-Ligand Interaction

    doi: 10.1016/j.chembiol.2017.06.015

    Figure Lengend Snippet:

    Article Snippet: In the second step, R103K was introduced into pET21 SAe-K121R-N82K by Gibson assembly of two PCR products: (product 1) PCR with primers 5’- CAGTACGTTGGTGGTGCTGAAGCTAAAATCAACACCCAGTGGTTGTTGACC and AmpB, (product 2) PCR with primers 5’- ACCACCAACGTACTGGCCAGACC and AmpA. pET21 SAe-K121R-K80R (“3-amine”) was introduced into SAe-K121R by Gibson assembly of two PCR products: (product 1) PCR with primers 5’- TCTGGGTTGGACCGTTGCTTGGCGCAACAACTACCGTAACGCTCAC and AmpB, (product 2) PCR with primers 5’-CCAAGCAACGGTCCAACCCAGAG and AmpA. pET21 SAe-K121R-K132R-K134R (“2-amine”) was introduced into SAe-K121R template by Gibson assembly of two PCR products: (product 1) PCR with 5’- GGTCACGACACCTTCACCCGTGTTCGTCCGTCCGCTGCTTCCG and AmpB, (product 2) PCR with 5’- GGTGAAGGTGTCGTGACCAACC and AmpA. pET21 SAe-K121R-K80R-K132R-K134R (“1-amine”, Flavidin) (GenBank accession number MF150043, Addgene plasmid #89881) was introduced into the SAe-K121R-K132R-K134R template by Gibson assembly using the two reactions described above for generating pET21 SAe-K121R-K80R.

    Techniques: Virus, Recombinant, Avidin-Biotin Assay, Blocking Assay, Plasmid Preparation, Bicinchoninic Acid Protein Assay, Sequencing, Software

    Validation of Flavidin Thermostability and Ligand Binding (A) Flavidin thermostability after heating for 3 min in PBS at the indicated temperature and then analysis of tetramer integrity by SDS-PAGE with Coomassie blue staining. C is a control boiled in SDS before loading. (B) Biotin-4-fluorescein association rates for Flavidin with or without 635P-NHS labeling (mean ± 1 SD, n = 9). (C) Biotin-4-fluorescein dissociation rates for Flavidin with or without 635P-NHS labeling (mean of triplicate ± 1 SD). See also <xref ref-type=Figure S4 . " width="100%" height="100%">

    Journal: Cell Chemical Biology

    Article Title: Amine Landscaping to Maximize Protein-Dye Fluorescence and Ultrastable Protein-Ligand Interaction

    doi: 10.1016/j.chembiol.2017.06.015

    Figure Lengend Snippet: Validation of Flavidin Thermostability and Ligand Binding (A) Flavidin thermostability after heating for 3 min in PBS at the indicated temperature and then analysis of tetramer integrity by SDS-PAGE with Coomassie blue staining. C is a control boiled in SDS before loading. (B) Biotin-4-fluorescein association rates for Flavidin with or without 635P-NHS labeling (mean ± 1 SD, n = 9). (C) Biotin-4-fluorescein dissociation rates for Flavidin with or without 635P-NHS labeling (mean of triplicate ± 1 SD). See also Figure S4 .

    Article Snippet: Requests for plasmids for Flavidin (pET21-Flavidin, https://www.addgene.org/89881/ ) and K121R mutant (pET21-Streptavidin-K121R, https://www.addgene.org/89880/ ) may also be made from Addgene.

    Techniques: Biomarker Discovery, Ligand Binding Assay, SDS Page, Staining, Control, Labeling

    Journal: Cell Chemical Biology

    Article Title: Amine Landscaping to Maximize Protein-Dye Fluorescence and Ultrastable Protein-Ligand Interaction

    doi: 10.1016/j.chembiol.2017.06.015

    Figure Lengend Snippet:

    Article Snippet: Requests for plasmids for Flavidin (pET21-Flavidin, https://www.addgene.org/89881/ ) and K121R mutant (pET21-Streptavidin-K121R, https://www.addgene.org/89880/ ) may also be made from Addgene.

    Techniques: Virus, Recombinant, Avidin-Biotin Assay, Blocking Assay, Plasmid Preparation, Bicinchoninic Acid Protein Assay, Sequencing, Software

    Journal: Cell Chemical Biology

    Article Title: Amine Landscaping to Maximize Protein-Dye Fluorescence and Ultrastable Protein-Ligand Interaction

    doi: 10.1016/j.chembiol.2017.06.015

    Figure Lengend Snippet:

    Article Snippet: pET21_Flavidin , This paper , Addgene Plasmid: #89881.

    Techniques: Recombinant, Avidin-Biotin Assay, Blocking Assay, Plasmid Preparation, Bicinchoninic Acid Protein Assay, Sequencing, Software